After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human AKT3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AKT3cDNA Clone Product Information
cDNA Size:1440
cDNA Description:ORF Clone of Homo sapiens v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) DNA.
Gene Synonym:PKBG, PRKBG, STK-2, PKB-GAMMA, RAC-gamma, RAC-PK-gamma, DKFZp434N0250, AKT3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

v-akt murine thymoma viral oncogene homolog 3 (AKT3), also known as PKB-GAMMA, with AKT1/PKBalpha, AKT2/PKBbeta, are the memerbers of Akt kinase family, share extensive structural similarity and perform common as well as unique functions within cells. The Akt signaling cascade initiates at the cell surface when growth factors or other extracellular stimuli activate phosphoinositide 3-kinase (PI3K). AKT3 was discovered to be the predominant isoform activated in sporadic melanomas. Levels of activity increased during melanoma progression with metastatic melanomas having the highest activity. Although mechanisms of AKT3 activation remain to be fully characterized, overexpression of AKT3 and decreased PTEN activity play important roles in this process. Targeted reduction of AKT3 activity decreased survival of melanoma tumor cells leading to inhibition of tumor development, which may be therapeutically effective for shrinking tumors in melanoma patients. AKT2 and AKT3 play an important role in the viability of human malignant glioma cells. Targeting AKT2 and AKT3 may hold promise for the treatment of patients with gliomas.

  • Mure H, et al. (2010) Akt2 and Akt3 play a pivotal role in malignant gliomas. Neuro Oncol. 12(3): 221-32.
  • Koseoglu S, et al. (2007) AKT1, AKT2 and AKT3-dependent cell survival is cell line-specific and knockdown of all three isoforms selectively induces apoptosis in 20 human tumor cell lines. Cancer Biol Ther. 6(5): 755-62.
  • Cristiano BE, et al. (2006) A specific role for AKT3 in the genesis of ovarian cancer through modulation of G(2)-M phase transition. Cancer Res. 66(24): 11718-25.
  • Robertson GP. (2005) Functional and therapeutic significance of Akt deregulation in malignant melanoma. Cancer Metastasis Rev. 24(2): 273-85.
  • Altomare DA, et al. (2005) Perturbations of the AKT signaling pathway in human cancer. Oncogene. 24: 7455-64.
  • Stahl JM, et al. (2004) Deregulated Akt3 activity promotes development of malignant melanoma. Cancer Res. 64: 7002-10.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items