Quick Order

Human DAPK3 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DAPK3 cDNA Clone Product Information
Gene_bank_ref_id:NM_001348.1
RefSeq ORF Size:1365bp
cDNA Description:Full length Clone DNA of Homo sapiens death-associated protein kinase 3 with C terminal Myc tag.
Gene Synonym:ZIP, ZIPK, FLJ36473, DAPK3
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Death-associated protein kinase 3, also known as DAP kinase 3, ZIP-kinase, DAPK3 and ZIPK, is a nucleus and cytoplasm protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and DAP kinase subfamily. DAPK3 / ZIPK contains one protein kinase domain. It is a serine/threonine kinase which acts as a positive regulator of apoptosis. It phosphorylates histone H3 on 'Thr-11' at centromeres during mitosis. DAPK3 / ZIPK is a homodimer or forms heterodimers with ATF4. Both interactions require an intact leucine zipper domain and oligomerization is required for full enzymatic activity. It also binds to DAXX and PAWR, possibly in a ternary complex which plays a role in caspase activation. DAPK3 / ZIPK regulates myosin light chain phosphatase through phosphorylation of MYPT1 thereby regulating the assembly of the actin cytoskeleton, cell migration, invasiveness of tumor cells, smooth muscle contraction and neurite outgrowth. It is involved in the formation of promyelocytic leukemia protein nuclear body (PML-NB), one of many subnuclear domains in the eukaryotic cell nucleus, and which is involved in oncogenesis and viral infection.

References
  • Kawai T., et al., 1998, Mol. Cell. Biol. 18:1642-1651.
  • Murata-Hori M., et al., 1999, FEBS Lett. 451:81-84.
  • Kawai T., et al., 2003, Mol. Cell. Biol. 23:6174-6186.
  • Greenman C., et al., 2007, Nature 446:153-158.
  • Ohbayashi N., et al., 2008, Biochem. Biophys. Res. Commun. 372: 708 -712.
  • Size / Price
    Catalog: HG10757-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"