After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human VTCN1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VTCN1 cDNA Clone Product Information
Gene_bank_ref_id:NM_024626.2
RefSeq ORF Size:849bp
cDNA Description:Full length Clone DNA of Homo sapiens V-set domain containing T cell activation inhibitor 1 with C terminal Myc tag.
Gene Synonym:B7X, B7H4, B7S1, B7-H4, B7h.5, VCTN1, PRO1291, FLJ22418, RP11-229A19.4, VTCN1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:pCMV3-VTCN1-Myc
Restriction Site:KpnI + XbaI (6kb + 0.89kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

V-set domain-containing T-cell activation inhibitor 1, also known as B7X, B7H4, B7S1, and VTCN1, is a single-pass type? membrane protein belonging to the B7 family of costimulatory proteins. These proteins are expressed on the surface of antigen-presenting cells and interact with ligands on T lymphocytes. They provide costimulatory signals that regulate T cell responses. A soluble form of B7H4 has also been detected. B7X / VTCN1 / B7H4 negatively regulates T-cell-mediated immune response by inhibiting T-cell activation, proliferation, cytokine production and development of cytotoxicity. When expressed on the cell surface of tumor macrophages, B7X / VTCN1 / B7H4 plays an important role, together with regulatory T-cells(Treg), in the suppression of tumor-associated antigen-specific T-cell immunity. B7X / VTCN1 / B7H4 is also involved in promoting epithelial cell transformation. This membrane protein can be up-regulated by IL6 / interleukin-6 and IL10 / interleukin-10 and inhibited by CSF2 / GM-CSF and IL4 / interleukin-4 on antigen-presenting cells.

References
  • Zang X, et al. (2003) B7x: a widely expressed B7 family member that inhibits T cell activation. Proc Natl Acad Sci U S A. 100(18): 10388-92.
  • Suh WK, et al. (2006) Generation and characterization of B7-H4/B7S1/B7x-deficient mice. Mol Cell Biol. 26(17): 6403-11.
  • Zang X, et al. (2007) B7-H3 and B7x are highly expressed in human prostate cancer and associated with disease spread and poor outcome. Proc Natl Acad Sci U S A. 104(49):19458-63.
  • Size / Price
    Catalog: HG10738-CM
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"