Quick Order

Text Size:AAA

Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IRAK4cDNA Clone Product Information
Gene_bank_ref_id:NM_016123.3
cDNA Size:1383
cDNA Description:ORF Clone of Homo sapiens interleukin-1 receptor-associated kinase 4 DNA.
Gene Synonym:IPD1, REN64, NY-REN-64, IRAK4
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10735-ACG$325
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10735-ACR$325
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10735-ANG$325
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10735-ANR$325
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10735-CF$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10735-CH$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10735-CM$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10735-CY$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone)HG10735-M$95
Human IRAK4 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10735-M-F$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10735-M-N$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10735-NF$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10735-NH$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10735-NM$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10735-NY$295
Human IRAK4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10735-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Interleukin-1 receptor-associated kinase 4, also known as Renal carcinoma antigen NY-REN-64, IRAK-4 and IRAK4, is a member of the protein kinase superfamily, TKL Ser/Thr protein kinase family and Pelle subfamily. IRAK4 contains one death domain and one protein kinase domain. IRAK4 is required for the efficient recruitment of IRAK1 to the IL-1 receptor complex following IL-1 engagement, triggering intracellular signaling cascades leading to transcriptional up-regulation and mRNA stabilization. It also phosphorylates IRAK1. A member of the IL-1 receptor (IL-1R)-associated kinase (IRAK) family, IRAK4, has been shown to play an essential role in Toll-like receptor (TLR)-mediated signaling. IL-1-mediated IRAK4 kinase activity in T cells is essential for induction of IL-23R expression, Th17 differentiation, and autoimmune disease. Pharmacological blocking of IRAK4 kinase activity will retain some levels of host defence, while reducing the levels and duration of inflammatory responses, which should provide beneficial therapies for sepsis and chronic inflammatory diseases. Defects in IRAK4 are the cause of recurrent isolated invasive pneumococcal disease type 1 (IPD1) which is defined as two episodes of IPD occurring at least 1 month apart, whether caused by the same or different serotypes or strains. Recurrent IPD occurs in at least 2% of patients in most series, making IPD the most important known risk factor for subsequent IPD. Defects in IRAK4 are also the cause of IRAK4 deficiency which causes extracellular pyogenic bacterial and fungal infections in otherwise healthy children.

References
  • Strelow,A. et al., 2003, FEBS Lett. 547 (1-3):157-61.
  • Kim,T.W. et al., 2007, J Exp Med. 204 (5):1025-36.
  • Trumstedt,C. et al., 2007, J Leukoc Biol. 81 (6):1591-8.
  • Li,X. et al., 2008, Eur J Immunol. 38 (3):614-8.
  • Staschke,K.A. et al., 2009, J Immunol. 183 (1): 568-77. 
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"