Quick Order

Text Size:AAA

Human PRSS7 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EnterokinasecDNA Clone Product Information
cDNA Size:3060
cDNA Description:ORF Clone of Homo sapiens protease, serine, 7 (enterokinase) DNA.
Gene Synonym:ENTK, MGC133046, PRSS7
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Enterokinase, or Enteropeptidase is a type II transmembrane, which is a member of the trypsin family of serine proteases, and plays a key role in mammalian metabolism. It is synthesized as a zymogen (proenteropeptidase) that requires activation by another protease, either trypsin or possibly duodenase. Active enteropeptidase then converts the pancreatic precursor, trypsinogen, to trypsin by cleavage of the specific trypsinogen activation peptide, Asp-Asp-Asp-Asp-Lys- Ile that is highly conserved in vertebrates. The mature trypsin in turn activates other proenzymes including chymotrypsinogen, procarboxypeptidases, and proelastases. Enterokinase consists of two subunits linked by a disulfide bond. The heavy chain achors enterokinase in the intestinal brush border membrane and the light chain is the catalytic subunit, which has the same mechanism of action as trypsin and chymotrypsin. Enterokinase is the physiological activator of trypsinogen and has a specificity for the sequence (Asp)4-Lys-Ile. Because of its high specificity towards the amino acid sequence (Asp)(4)-Lys, enterokinase is a potential tool for the cleavage of fusion proteins, which are gaining more importance in biopharmaceutical production. In addition, Enterokinase is a tool protease widely utilized in the cleavage of recombinant fusion proteins.

  • Light A, et al. (1989) Enterokinase (enteropeptidase): comparative aspects. Trends Biochem Sci. 14(3): 110-2.
  • Kubitzki T, et al. (2009) Application of immobilized bovine enterokinase in repetitive fusion protein cleavage for the production of mucin 1. Biotechnol J. 4(11): 1610-8.
  • Zheng XL, et al. (2009) Enteropeptidase, a type II transmembrane serine protease. Front Biosci (Elite Ed). 1: 242-9.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks