Quick Order

Text Size:AAA

Human PDK / PDZ binding kinase / TOPK ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PBK cDNA Clone Product Information
Gene_bank_ref_id:NM_018492.2
RefSeq ORF Size:969bp
cDNA Description:Full length Clone DNA of Homo sapiens PDZ binding kinase with C terminal Myc tag.
Gene Synonym:SPK, TOPK, Nori-3, FLJ14385, PBK
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human PDK / PDZ binding kinase / TOPK ORF mammalian expression plasmid, C-Myc tag on other vectors
Product nameProduct name
Background

PDZ binding kinase (PBK), also known as TOPK (T-LAK cell-originated protein kinase), is a serine/threonine kinase related to the dual specific mitogen-activated protein kinase kinase (MAPKK) family, and has all the characteristic protein kinase subdomains and a C-terminal PDZ-binding T/SXV motif. PBK is expressed in the testis restrictedly expressed in outer cell layer of seminiferous tubules, as well as placenta. PBK may be enrolled in the activation of lymphoid cells and support testicular functions, with a suggested role in the process of spermatogenesis.This mitotic kinase phosphorylates MAP kinase p38 and seems to be active in mitosis. When phosphorylated, PBK forms a protein-protein interaction with tumor suppressor p53 (TP53), leading to TP53 destabilization and attenuation of G2/M checkpoint during doxorubicin-induced DNA damage. The expression level of PBK is thus upregulated in a variety of neoplasms including hematological malignancies.

Size / Price
Catalog: HG10729-CM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"