Quick Order

Cynomolgus monkey SERPINA3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINA3cDNA Clone Product Information
Gene_bank_ref_id:XM_005562128.1
cDNA Size:1272
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 DNA.
Gene Synonym:SERPINA3
Species:Cynomolgus
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Human SerpinA3, also known as Alpha 1-antichymotrypsin (AACT), is a plasma alpha globulin glycoprotein, and is a member of serpin superfamily of the serine protease inhibitors consisting of at least 35 members. SerpinA3 has been demonstrated to inhibit the activity of certain serine proteases, such as cathepsin G found in neutrophils, and chymases present in mast cells, by inducing a major conformational rearrangement, and thus protects some tissues from damage caused by proteolytic enzymes. This enzyme is produced primarily in the liver, and is identified as an acute-phase inflammatory protein. SerpinA3 deficiency has been associated with liver disease, and mutations of this gene have been observed in patients with Parkinson disease and chronic obstructive pulmonary disease. In addition, ACT gene polymorphism has been implicated with Alzheimer’s disease (AD), cerebral amyloid angiopathy (CAA), as well as stroke, since SerpinA3 is a major constituent of the plaques in AD and an inhibitor of amyloid beta peptide degradation.

References
  • Nilsson, L.N. et al., 2001, J. Neurosci. 21: 1444-1451.
  • Ikari, Y. et al., 2001, J. Biol. Chem. 276: 11798-11803.
  • Vila, N. et al., 2000, Stroke. 31: 2103-2105
  • Eriksson, S. et al., 1995, Proc. Natl. Acad. Sci. USA. 92: 2313-2317.
  • Skeel, A. et al., 2001, J. Biol. Chem. 276: 21932-21937.
  • Size / Price
    Catalog:CG90719-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"