Quick Order

Rhesus RHEB ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus RHEB cDNA Clone Product Information
NCBI RefSeq:NM_001261182.1
RefSeq ORF Size:555bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) Ras homolog enriched in brain with N terminal Myc tag.
Gene Synonym:RHEB
Species:Rhesus
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

RHEB is a recently discovered member of the Ras superfamily that may be involved in neural plasticity. This function is novel and not typically associated with the Ras proteins. RHEB gene is a member of the small GTPase superfamily and encodes a lipid-anchored, cell membrane protein with five repeats of the RAS-related GTP-binding region. RHEB is vital in regulation of growth and cell cycle progression due to its role in the insulin / TOR / S6K signaling pathway. The protein has GTPase activity and shuttles between a GDP-bound form and a GTP-bound form, and farnesylation of RHEB is required for this activity. Three pseudogenes have been mapped, two on chromosome 10 and one on chromosome 22.

References
  • Karbowniczek, et al. (2004) Regulation of B-Raf kinase activity by tuberin and Rheb is mammalian target of rapamycin (mTOR)-independent. J Biol Chem. 279(29):29930-7.
  • Long, et al. (2005) Rheb binds and regulates the mTOR kinase. Curr Biol. 15(8):702-13.
  • Mizuki N, et al. (1996) Isolation of cDNA and genomic clones of a human Ras-related GTP-binding protein gene and its chromosomal localization to the long arm of chromosome 7, 7q36. Genomics. 34(1):114-8.
  • Size / Price
    Catalog: CG90714-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"