Quick Order

Cynomolgus monkey OMG Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
OMGcDNA Clone Product Information
cDNA Size:1323
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) oligodendrocyte myelin glycoprotein DNA.
Gene Synonym:OMG
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Mouse oligodendrocyte-myelin glycoprotein, also known as OMG and OMGP, is a cell membrane protein which contains eight LRR (leucine-rich) repeats. OMG / OMGP is a glycosylphosphatidylinositol-anchored protein expressed by neurons and oligodendrocytes in the central nervous system (CNS). OMG / OMGP is a cell adhesion molecule contributing to the interactive process required for myelination in the central nervous system. OMG / OMGP play roles in both the developing and adult central nervous system. OMG / OMGP participats in growth cone collapse and inhibition of neurite outgrowth through its interaction with NgR, the receptor for Nogo. This function requires its leucine-rich repeat domain, a highly conserved region in OMgp during mammal evolution. OMG / OMGP leucine-rich repeat domain is also implicated in the inhibition of cell proliferation. OMG / OMGP may also be involved in the formation and maintenance of myelin sheaths. Cell proliferation, neuronal sprouting and myelination are crucial processes involved in brain development and regeneration after injury.