After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CAMK2AcDNA Clone Product Information
cDNA Size:1437
cDNA Description:ORF Clone of Homo sapiens calcium/calmodulin-dependent protein kinase II alpha DNA.
Gene Synonym:CAMKA, KIAA0968
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10648-ACG$325
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10648-ACR$325
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10648-ANG$325
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10648-ANR$325
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10648-CF$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10648-CH$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10648-CM$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10648-CY$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone)HG10648-M$95
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10648-M-F$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10648-M-N$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10648-NF$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10648-NH$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10648-NM$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10648-NY$295
Human CaM Kinase 2A Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10648-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Ca2+/calmodulin-dependent protein kinase2A (CAMK2A) belongs to the serine/threonine protein kinase family and, together with other 28 different isoforms, belongs to the Ca2+/ calmodulin-dependent protein kinase subfamily. CaM kinase Ⅱ is thought to be an important mediator of learning and memory and is also necessary for Ca2+ homeostasis and reuptake in cardiomyocytes chloride transport in epithelia, positive T-cell selection, and CD8 T-cell activation. CAMKIIA is one of the major forms of CAMKII. It has been found to play a critical role in sustaining activation of CAMKII at the postsynaptic density. Studies have found that knockout mice without CAMKIIA demonstrate a low frequency of LTP. Additionally, these mice do not form persistent, stable place cells in the hippocampus.

  • Lin CR, et al. (1987). Molecular cloning of a brain-specific calcium/calmodulin-dependent protein kinase. Proc Natl Acad Sci U S A. 84 (16): 5962-6.
  • Walikonis RS, et al. (2001) Densin-180 forms a ternary complex with the (alpha)-subunit of Ca2+/calmodulin-dependent protein kinase II and (alpha)-actinin. J Neurosci. 21 (2): 423-33.
  • Gardoni F, et al. (2003) CaMKII-dependent phosphorylation regulates SAP97/NR2A interaction. J Biol Chem. 278 (45): 44745-52.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items