Quick Order

Human SerpinB2 ORF mammalian expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human SERPINB2 cDNA Clone Product Information
NCBI RefSeq:NM_002575.1
RefSeq ORF Size:1248bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 2 with C terminal Myc tag.
Gene Synonym:PAI, PAI2, PAI-2, PLANH2, HsT1201
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner.
SerpinB2, also known as Plasminogen activator inhibitor 2, Placental plasminogen activator inhibitor, Monocyte Arg-serpin, Urokinase inhibitor and PAI2, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB2 is a major product of activated monocytes and macrophages and is substantially induced during most inflammatory processes. Distinct from its widely described extracellular role as an inhibitor of urokinase plasminogen activator. SerpinB2 has been shown to have an intracellular role as a retinoblastoma protein (Rb)-binding protein that inhibits Rb degradation. SerpinB2 is widely described as an inhibitor of urokinase plasminogen activator. SerpinB2 inhibits urokinase-type plasminogen activator. The monocyte derived SerpinB2 is distinct from the endothelial cell-derived PAI-1. SerpinB2 is a potentially important inducible host factor that significantly promotes HIV-1 replication.

References
  • Sumi, Y. et al., 1989, J. Biochem. 106: 703-7.
  • Rawlings, N.D. et al., 2004, Biochem J. 378: 705-16.
  • Gillard, A. et al., 2006, Am J Nephrol. 26 (1): 34-42.
  • Schroder,WA. et al., 2010, J Immunol. 184 (5): 2663-70.
  • Size / Price
    Catalog: HG10641-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"