After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CCL27 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCL27cDNA Clone Product Information
Gene_bank_ref_id:NM_006664.2
cDNA Size:339
cDNA Description:ORF Clone of Homo sapiens chemokine (C-C motif) ligand 27 DNA.
Gene Synonym:ALP, ILC, CTAK, CTACK, PESKY, ESKINE, SCYA27
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Chemokine & Receptor Related Products
Product nameProduct name
Background

CCL27, also known as CTACK, is a small cytokine belonging to the CC chemokine family. Members of this family are proteins characterized by two adjacent cysteines. CCL27 is chemotactic for skin-associated memory T lymphocytes. CCL27 may also play a role in mediating homing of lymphocytes to cutaneous sites. CCL27 plays a pivotal role in establishing the inflammatory infiltrate characteristic for common inflammatory skin diseases. Through binding to the chemokine receptor 10 (CCR10), CCL27 mediates inflammation by promoting lymphocyte migration into the skin.

References
  • Morales. et al., 1999, Proc Natl Acad Sci. 96: 14470-5.
  • Homey. et al., 2002, J Immunol. 164: 3465-70.
  • Ishikawa-Mochizuki. et al., 1999, FEBS Lett. 460: 544-8.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"