Quick Order

Human CystatinC / CST3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CST3cDNA Clone Product Information
cDNA Size:441
cDNA Description:ORF Clone of Homo sapiens cystatin C DNA.
Gene Synonym:ARMD11, MGC117328, CST3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Cystatin C, also known as Cystatin-3 (CST3) is a secreted type 2 cysteine protease inhibitor synthesized in all nucleated cells, has been proposed as a replacement for serum creatinine for the assessment of renal function, particularly to detect small reductions in glomerular filtration rate. The mature, active form of human cystatin C is a single non-glycosylated polypeptide chain consisting of 120 amino acid residues, with a molecular mass of 13,343-13,359 Da, and containing four characteristic disulfide-paired cysteine residues. Cystatin C is a low-molecular-weight protein which has been proposed as a marker of renal function that could replace creatinine. Indeed, the concentration of Cystatin C is mainly determined by glomerular filtration and is particularly of interest in clinical settings where the relationship between creatinine production and muscle mass impairs the clinical performance of creatinine. Since the last decade, numerous studies have evaluated its potential use in measuring renal function in various populations. More recently, other potential developments for its clinical use have emerged. In almost all the clinical studies, Cystatin C demonstrated a better diagnostic accuracy than serum creatinine in discriminating normal from impaired kidney function, but controversial results have been obtained by comparing this protein with other indices of kidney disease, especially serum creatinine-based equations, such as early atherosclerosis, Alzheimer's dementia, vascular aneurysms, hyperhomocysteinaemia and other neurodegenerative diseases. Cystatin C could be a useful clinical tool to identify HIV-infected persons. In addition, its expression is up-regulated in malignance of certain tumor progression.

  • Mares J, et al. (2003) Use of cystatin C determination in clinical diagnostics. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 147(2): 177-80.
  • Mussap M, et al. (2004) Biochemistry and clinical role of human cystatin C. Crit Rev Clin Lab Sci. 41(5-6): 467-550.
  • Sronie-Vivien S, et al. (2008) Cystatin C: current position and future prospects. Clin Chem Lab Med. 46(12): 1664-86.
  • Taglieri N, et al. (2009) Cystatin C and cardiovascular risk. Clin Chem. 55(11): 1932-43.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks