Quick Order

Text Size:AAA

Human CystatinB ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CSTB cDNA Clone Product Information
Gene_bank_ref_id:NM_000100.2
RefSeq ORF Size:297bp
cDNA Description:Full length Clone DNA of Homo sapiens cystatin B (stefin B) with C terminal Myc tag.
Gene Synonym:PME, CST6, EPM1, STFB, CSTB
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Cystatin-B, also known as CPI-B, Liver thiol proteinase inhibitor, Stefin-B, CSTB and CST6, is a cytoplasm and nucleus protein which belongs to the cystatin family. Cystatin-B / CSTB is an intracellular thiol proteinase inhibitor. Tightly binding reversible inhibitor of cathepsins L, H and B. Cystatin-B / CSTB is able to form a dimer stabilized by noncovalent forces, inhibiting papain and cathepsins l, h and b. Cystatin-B / CSTB is also thought to play a role in protecting against the proteases leaking from lysosomes. Defects in Cystatin-B / CSTB are the cause of progressive myoclonic epilepsy type 1 (EPM1) which is an autosomal recessive disorder characterized by severe, stimulus-sensitive myoclonus and tonic-clonic seizures. The cystatins are a family of cysteine protease inhibitors with homology to chicken cystatin. Cystatins are physiological inhibitors of cysteine proteinases which are widely distributed in human tissues and fluids. Cystatins typically comprise about 115 amino acids, are largely acidic, contain four conserved cysteine residues known to form two disulfide bonds. Cystatins may be glycosylated and / or phosphorylated, with similarity to fetuins, kininogens, stefins, histidine-rich glycoproteins and cystatin-related proteins. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired inhibitory activity. Cystatins mainly inhibit peptidases belonging to peptidase families C1 (papain family) and C13 (legumain family).

Size / Price
Catalog: HG10435-CM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"