After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human CD144 / CDH5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDH5cDNA Clone Product Information
cDNA Size:2335
cDNA Description:ORF Clone of Homo sapiens cadherin 5, type 2, VE-cadherin (vascular epithelium) DNA.
Gene Synonym:7B4, CD144, FLJ17376, CDH5
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Cadherins (Calcium dependent adhesion molecules) are a class of transmembrane proteins. Cadherin-5, also known as VE-cadherin, CDH5 and CD144, an endothelial specific cell-cell adhesion molecule, plays a pivotal role in the formation, maturation and remodeling of the vascular wall. VE-Cadherin is widely considered to be specific for vascular endothelia in which it is either the sole or the predominant cadherin, often co-existing with N-cadherin. This specificity of VE-cadherin for vascular endothelial cells is important not only in blood and lymph vessel biology and medicine, but also for cell-type-based diagnoses, notably those of metastatic tumors. As a classical cadherin, VE-Cadherin links endothelial cells together by homophilic interactions mediated by its extracellular part and associates intracellularly with the actin cytoskeleton via catenins. Mechanisms that regulate VE-cadherin-mediated adhesion are important for the control of vascular permeability and leukocyte extravasation. In addition to its adhesive functions, VE-Cadherin regulates various cellular processes such as cell proliferation and apoptosis and modulates vascular endothelial growth factor receptor functions. Consequently, VE-cadherin is essential during embryonic angiogenesis.

  • Taveau JC, et al. (2008) Structure of artificial and natural VE-cadherin-based adherens junctions. Biochem Soc Trans. 36(Pt 2): 189-93.
  • Vestweber D. (2008) VE-cadherin: the major endothelial adhesion molecule controlling cellular junctions and blood vessel formation. Arterioscler Thromb Vasc Biol. 28(2): 223-32.
  • Gavard J. (2009) Breaking the VE-cadherin bonds. FEBS Lett. 583(1): 1-6.
  • Vestweber D, et al. (2009) Cell adhesion dynamics at endothelial junctions: VE-cadherin as a major player. Trends Cell Biol. 19(1): 8-15.
  • Boda-Heggemann J, et al. (2009) Beyond vessels: occurrence and regional clustering of vascular endothelial (VE-)cadherin-containing junctions in non-endothelial cells. Cell Tissue Res. 335(1): 49-65.