After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human KLK-7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KLK7cDNA Clone Product Information
cDNA Size:762
cDNA Description:ORF Clone of Homo sapiens kallikrein-related peptidase 7 (KLK7), transcript variant 1 DNA.
Gene Synonym:SCCE, PRSS6, KLK7
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human KLK-7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human KLK-7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10416-ACG$325
Human KLK-7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10416-ACR$325
Human KLK-7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10416-CF$295
Human KLK-7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10416-CH$295
Human KLK-7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10416-CM$295
Human KLK-7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10416-CY$295
Human KLK-7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10416-M$95
Human KLK-7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10416-M-F$295
Human KLK-7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10416-NF$295
Human KLK-7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10416-NH$295
Human KLK-7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10416-NM$295
Human KLK-7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10416-NY$295
Human KLK-7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10416-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Kallikrein-7, also known as kallikrein-related peptidase 7, Stratum corneum chymotryptic enzyme, Serine protease 6, KLK7, and PRSS6, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. Members of the Kallikrein family are involved in various malignancies such as prostate (PSA, KLK2, KLK15), ovarian (KLK4, KLK5, KLK6, KLK8, KLK10), and breast cancer (KLK10, KLK13, KLK14). Kallikrein-7 / KLK7 appears to be increased in ovarian cancer and higher KLK7 expression in ovarian cancer tissue is associated with poorer prognosis of ovarian cancer patients. Kallikrein-7 / KLK7 is abundantly expressed in the skin and is expressed by keratinocytes in the epidermis. Kallikrein-7 / KLK7 is up-regulated in ovarian carcinoma, especially late-stage serous carcinoma, compared with normal ovaries and benign adenomas (at the protein level). It was significantly associated with shorter overall survival (OS) and disease-free survival (DFS). Kallikrein-7 / KLK7 may catalyze the degradation of intercellular cohesive structures in the cornified layer of the skin in the continuous shedding of cells from the skin surface. KLK7 also plays a role in the activation of precursors to inflammatory cytokines.