Quick Order

Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TGFB2cDNA Clone Product Information
Gene_bank_ref_id:NM_003238.3
cDNA Size:1245
cDNA Description:ORF Clone of Homo sapiens transforming growth factor, beta 2 (TGFB2), transcript variant 2 DNA.
Gene Synonym:MGC116892, TGF-beta2, TGFB2
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10382-ACG$325
Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10382-ACR$325
Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10382-CF$295
Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10382-CH$295
Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10382-CM$295
Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10382-CY$295
Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone)HG10382-M$95
Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10382-M-F$295
Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, His-taggedHG10382-M-H$295
Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10382-M-N$295
Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10382-NF$295
Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10382-NH$295
Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10382-NM$295
Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10382-NY$295
Human TGF-beta2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10382-UT$295
 Learn more about expression Vectors
Transforming Growth Factor Beta (TGF-beta) Family Related Products
Product nameProduct name
Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Human ALK-2 / ACVR1 Protein (His & Fc Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human TGFBR2 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Human ALK4 / ACVR1B Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinHuman BAMBI / NMA Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human ATF2 Protein (His & GST Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Mouse Smad5 ProteinMouse BAMBI / NMA Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rat Cripto / TDGF1 Protein (Fc Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Cynomolgus TGFBR2 Protein (Fc Tag)Cynomolgus ACVR1B / ALK-4 Protein (Fc Tag)Cynomolgus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)
Background

TGF beta 2 (Transforming growth factor beta 2), an extracellular glycosylated protein, which belongs to the TGF-beta family. TGF-beta regulates key mechanisms of tumor development, namely immunosuppression, metastasis, angiogenesis, and proliferation. TGF beta 2 suppression is a promising therapeutic approach for malignant tumor therapy. The signaling pathway of TGF beta 2/Smad plays an important role in the pathological process in posterior capsule opacification (PCO) after cataract surgery. Silencing Smad2 and Smad3 efficiently blocked the effect of TGF beta 2 on cell proliferation, migration, and extracellular matrix production. TGF beta 2 activation of MEKK3/ERK1/2/5 signaling modulates Has2 expression and hyaluronan (HA) production leading to the induction of epithelial to mesenchymal transformation (EMT) events. In addition, the upregulation of the TGF beta 2 level is a common pathological feature of Alzheimer's disease (AD) brains and suggests that it may be closely linked to the development of neuronal death related to AD.

References
  • Schlingensiepen KH, et al. (2006) Targeted tumor therapy with the TGF-beta 2 antisense compound AP 12009. Cytokine Growth Factor Rev. 17(1-2): 129-39.
  • Ghatpande SK, et al. (2010) Transforming growth factor beta2 is negatively regulated by endogenous retinoic acid during early heart morphogenesis. Dev Growth Differ. 52(5): 433-55.
  • Noguchi A, et al. (2010) Transforming growth factor beta2 level is elevated in neurons of Alzheimer's disease brains. Int J Neurosci. 120(3): 168-75.
  • Li J, et al. (2011) Comparative effects of TGF-_2/Smad2 and TGF-_2/Smad3 signaling pathways on proliferation, migration, and extracellular matrix production in a human lens cell line. Exp Eye Res. 92(3): 173-9.
  • Size / Price
    Catalog:HG10382-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"