Quick Order

Human SHH / Sonic Hedgehog ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SHH cDNA Clone Product Information
Gene_bank_ref_id:NM_000193.2
RefSeq ORF Size:1389bp
cDNA Description:Full length Clone DNA of Homo sapiens sonic hedgehog homolog (Drosophila) with C terminal Myc tag.
Gene Synonym:TPT, HHG1, HLP3, HPE3, SMMCI, TPTPS, MCOPCB5, SHH
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Sonic HedgeHog, also known as sonic hedgehog protein, belongs to the hedgehog family. It cannot be detected in adult tissues while can be found in fetal intestine, liver, lung, and kidney. Sonic HedgeHog is a protein that is vital in guding the early embryo. It has been associated as the major inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Sonic HedgeHog intercellular signal is essential for a various patterning events during development: signal produced by the notochord that induces ventral cell fate in the neural tube and somites, and the polarizing signal for patterning of the anterior-posterior axis of the developing limb bud. Sonic HedgeHog binds to the patched receptor, which functions in association with smoothened, to activate the transcription of target genes. In the absence of sonic HedgeHog, patched receptor represses the constitutive signaling activity of smoothened. Sonic HedgeHog also regulates another factor, the gli oncogene. Defects in sonic hedgehog can cause microphthalmia isolated with coloboma type 5, triphalangeal thumb-polysyndactyly syndrome and holoprosencephaly type 3.

References
  • Ericson J, et al. (1997) Graded sonic hedgehog signaling and the specification of cell fate in the ventral neural tube. Cold Spring Harb Symp Quant Biol. 62:451-66.
  • Marigo V, et al. (1996) Regulation of patched by sonic hedgehog in the developing neural tube. Proc Natl Acad Sci. 93(18):9346-51.
  • Stone DM, et al. (1996) he tumour-suppressor gene patched encodes a candidate receptor for Sonic hedgehog. Nature. 384:129-34.
  • Size / Price
    Catalog: HG10372-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"