After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BIRC5cDNA Clone Product Information
Gene_bank_ref_id:NM_001168.2
cDNA Size:429
cDNA Description:ORF Clone of Homo sapiens baculoviral IAP repeat-containing 5, transcript variant 1 DNA.
Gene Synonym:API4, EPR-1
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10356-ACG$325
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10356-ACR$325
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10356-ANG$325
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10356-ANR$325
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10356-CF$295
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10356-CH$295
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10356-CM$295
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10356-CY$295
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10356-M$95
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10356-M-N$295
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10356-NF$295
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10356-NH$295
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10356-NM$295
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10356-NY$295
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10356-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

BIRC5, also known as Survivin and EPR-1, is a member of the IAP family. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but BIRC5 has only a single BIR domain. It is expressed cell cycle-dependently and highly expressed at mitosis. As a multitasking protein, BIRC5 has dual roles in promoting cell proliferation and preventing apoptosis. Survivin is a component of a chromosome passage protein complex (CPC) which is essential for chromosome alignment and segregation during mitosis and cytokinesis. Survivin acts as an important regulator of the localization of this complex. It may counteract a default induction of apoptosis in G2/M phase.

References
  • Altieri DC. 1994, J Biol Chem. 269 (5): 3139-42.
  • Bouchard BA. et al., 2002, Thromb Haemost. 86 (4): 1133-5.
  • Yao XQ. et al., 2004, World J Gastroenterol. 10 (9): 1262-7.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"