Quick Order

Text Size:AAA

Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSNK2A1cDNA Clone Product Information
cDNA Size:1176
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) casein kinase 2, alpha 1 polypeptide DNA.
Gene Synonym:CSNK2A1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90444-ACG$325
Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90444-ACR$325
Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90444-ANG$325
Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90444-ANR$325
Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90444-CF$295
Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90444-CH$295
Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90444-CM$295
Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90444-CY$295
Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone)CG90444-G$95
Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90444-NF$295
Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90444-NH$295
Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90444-NM$295
Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90444-NY$295
Cynomolgus monkey CSNK2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90444-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Casein kinase II subunit alpha, also known as CK II alpha, CSNK2A1 and CK2A1, is a member of the protein kinase superfamily, Ser / Thr protein kinase family and CK2 subfamily. Casein kinase II (CSNK2A1) is a serine / threonine protein kinase that phosphorylates acidic proteins such as casein. This kinase is composed of an alpha, an alpha-prime, and two beta subunits. The alpha subunits contain the catalytic activity while the beta subunits undergo autophosphorylation. Casein kinase II (CSNK2A1) is a constitutively active, ubiquitously expressed serine / threonine protein kinase that is thought to have a regulatory function in cell proliferation, cell differentiation and apoptosis. CSNK2A1 functions as a tetrameric complex consisting of two regulatory beta-subunits and two catalytic units (alpha and alpha') in a homomeric or heteromeric conformation. Whilst the alpha- and alpha'-subunits are catalytically identical, proteins that regulate CSNK2A1, such as cdc2 and Hsp90, preferentially bind to the alpha and not the alpha'-subunit. CSNK2A1 can phosphorylate a number of key intracellular signaling proteins implicated in tumor suppression (p53 and PTEN) and tumorigenesis (myc, jun, NF-kappaB). CSNK2A1 is also thought to influence Wnt signaling via beta-catenin phosphorylation and the PI 3-K signaling pathway via th phosphorylation of Akt.

  • Schlpfer J, et al. (1997) A radiation hybrid framework map of bovine chromosome 13. Chromosome Res. 5(8): 511-9.
  • Wirkner U, et al. (1994) The human gene (CSNK2A1) coding for the casein kinase II subunit alpha is located on chromosome 20 and contains tandemly arranged Alu repeats. Genomics. 19(2): 257-65.
  • Wirkner U, et al. (1998) Genomic organization and promoter identification of the human protein kinase CK2 catalytic subunit alpha (CSNK2A1). Genomics. 48(1): 71-8.