After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GranzymeH ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GZMH cDNA Clone Product Information
NCBI RefSeq:NM_033423.3
RefSeq ORF Size:741bp
cDNA Description:Full length Clone DNA of Homo sapiens granzyme H (cathepsin G-like 2, protein h-CCPX) with C terminal Myc tag.
Gene Synonym:CCP-X, CGL-2, CSP-C, CTLA1, CTSGL2
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Granzymes are key components of the immune response that play important roles in eliminating host cells infected by intracellular pathogens. Several granzymes are potent inducers of cell death. A total of eight granzymes (A-G and M) have been identified in the mouse, but only five are known in humans (A, B, H, M and granzyme 3), and granzyme H appears to be specifically human. Human granzyme H is a neutral serine protease that is expressed predominantly in the lymphokine-activated killer (LAK)/natural?killer (NK) compartment of the immune system. In adenovirus-infected cells in which granzyme B (gzmB) and downstream apoptosis pathways are inhibited, granzyme H directly cleaves the adenovirus DNA-binding protein (DBP), a viral component absolutely required for viral DNA replication. This virus demonstrated that gzmH directly induces an important decay in viral DNA replication. Interestingly, gzmH also cleaves the adenovirus 100K assembly protein, a major inhibitor of gzmB, and relieves gzmB inhibition. Granzyme H has a very high amino acid identity (>90%) with many portions of the granzyme B sequence, particularly near the amino terminus of the molecule despite performing a distinct enzymic function.

Size / Price
Catalog: HG10348-CM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"