Quick Order

Human SerpinA5 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SERPINA5 cDNA Clone Product Information
Gene_bank_ref_id:NM_000624.4
RefSeq ORF Size:1221bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 with C terminal Myc tag.
Gene Synonym:PCI, PAI3, PROCI, PLANH3
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Serpin A5, also well known as protein C inhibitor (PCI), is a member of the human serpin superfamily consists of at least 35 members. It is synthesized in the liver and has been detected in saliva, cerebral spinal fluid, amniotic fluid, tears and semen. As a potent inhibitor of the protein C anticoagulant pathway at the levels of both zymogen activation and enzyme inhibition, serpinA5 additionally inhibits a variety of serine protease including thrombin, factor Xa, several kallekreins and acrosin, and plays a role in the processes of blood coagulation and fertilization. Serpin A5 also inhibits urinary plasminogen activator (uPA), a mediator of tumor cell invasion, and regulates tumor growth and metastasis by inhibiting angiogenesis. Furthermore, recent studies have identified PCI as a potent and direct inhibitor of activated HGFA (hepatocyte growth factor activator), suggesting a novel function in the regulation of tissue repair and regeneration. Similar to serpins C1 and D1, the thrombin inhibitory activity of serpinA5 is enhanced by heparin.

References
  • Alireza, R. et al., 1995, J. Biol. Chem. 270: 25336-25339.
  • Silverman, G.A. et al., 2001, J. Biol. Chem. 276: 33293-33296.
  • Malleier, J.M. et al., 2007, Blood. 109: 4769-4776.
  • Asanuma, K. et al., 2007, Int. J. Cancer. 121: 955-965.
  • Hayashi, T. et al., 2007, J. Thromb. Haemost. 5: 1477-1485.
  • Size / Price
    Catalog: HG10309-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"