Quick Order

Text Size:AAA

Human SerpinE1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINE1cDNA Clone Product Information
cDNA Size:1209
cDNA Description:ORF Clone of Homo sapiens serpin peptidase inhibitor, clade E(nexin,plasminogen activator inhibitor type 1), member 1 DNA.
Gene Synonym:PAI, PAI1, PAI-1, PLANH1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human SerpinE1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Related Products
Product nameProduct name

Plasminogen activator inhibitor 1, also known as PAI-1, Endothelial plasminogen activator inhibitor, SerpinE1 and PLANH1, is a secreted glycoprotein which belongs to the serpin family. SerpinE1 is the primary physiological inhibitor of the two plasminogen activators urokinase (uPA) and tissue plasminogen activator (tPA). Its rapid interaction with TPA may function as a major control point in the regulation of fibrinolysis. Defects in SerpinE1 are the cause of plasminogen activator inhibitor-1 deficiency (PAI-1 deficiency) which is characterized by abnormal bleeding due to SerpinE1 defect in the plasma. High concentrations of SerpinE1 have been associated with thrombophilia which is an autosomal dominant disorder in which affected individuals are prone to develop serious spontaneous thrombosis. Studies of PAI-1 have contributed significantly to the elucidation of the protease inhibitory mechanism of serpins, which is based on a metastable native state becoming stabilised by insertion of the RCL into the central beta-sheet A and formation of covalent complexes with target proteases. Greater expression of PAI-1 has been associated with increased survival of cells and resistance to apoptosis. PAI-1 appears to influence apoptosis by decreasing cell adhesion (anoikis) as well as its effect on intracellular signaling. PAI-1, in its active state, also binds to the extracellular protein vitronectin. When in complex with its target proteases, it binds with high affinity to endocytosis receptors of the low density receptor family. The mechanisms of PAI-1 overexpression during obesity are complex, and it is conceivable that several inducers are involved at the same time at several sites of synthesis. PAI-1 is also implicated in adipose tissue development. It suggests that PAI-1 inhibitors serve in the control of atherothrombosis.

  • Alessi MC, et al. (2006) PAI-1 and the metabolic syndrome: links, causes, and consequences. Arterioscler Thromb Vasc Biol. 26(10): 2200-7.
  • Schneider DJ, et al. (2008) The effect of plasminogen activator inhibitor type 1 on apoptosis. Thromb Haemost. 100(6): 1037-40.
  • Dupont DM, et al. (2009) Biochemical properties of plasminogen activator inhibitor-1. Front Biosci. 14: 1337-61.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items