After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ENO1cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:1305
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) enolase 1, (alpha) DNA.
Gene Synonym:ENO1
Species:Cynomolgus
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90355-ACG$325
Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90355-ACR$325
Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90355-ANG$325
Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90355-ANR$325
Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90355-CF$295
Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90355-CH$295
Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90355-CM$295
Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90355-CY$295
Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone)CG90355-G$95
Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90355-NF$295
Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90355-NH$295
Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90355-NM$295
Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90355-NY$295
Cynomolgus monkey ENO1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90355-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
References
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • Size / Price
    Catalog:CG90355-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"