After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey PTGFRN ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus PTGFRN cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:2640bp
cDNA Description:Full length Clone DNA of Macaca mulatta prostaglandin F2 receptor negative regulator with N terminal Myc tag.
Gene Synonym:PTGFRN
Species:Cynomolgus
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

EWI-F, also known as PTGFRN, is inversely related to the loss of CD9. Its expression correlates with the metastatic status of hLT (n=55). EWI-F inhibits the binding of prostaglandin F2-alpha (PGF2-alpha) to its specific FP receptor, by decreasing the receptor number rather than the affinity constant. EWI-F expression positively correlates with the metastatic status of hLT, and that the upregulation of EWI-F expression could be one of the mechanisms underlying the loss of CD9 in solid tumours.

References
  • Stipp C S. et al., 2001, J Biol Chem. 276 (7): 4853-62.
  • Charrin S. et al., 2001, J Biol Chem. 276 (17): 14329-37.
  • Orlicky DJ. et al., 1996, Hum Genet. 97 (5): 655-8.
  • Size / Price
    Catalog: CG90276-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"