Quick Order

Rhesus ART4 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus ART4 cDNA Clone Product Information
NCBI RefSeq:XM_001090760.2
RefSeq ORF Size:993bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) ADP-ribosyltransferase 4 (Dombrock blood group) with N terminal Myc tag.
Gene Synonym:ART4
Species:Rhesus
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

ADP-ribosyltransferase 4 (Dombrock blood group), also known as Mono-ADP-ribosyltransferase 4(ART4), Dombrock blood group carrier molecule and CD297, is a protein that contains a mono-ADP-ribosylation (ART) motif. It is a member of the ADP-ribosyltransferase gene family but enzymatic activity has not been demonstrated experimentally. ADP-ribosyltransferase catalyzes the ADP-ribosylation of arginine residues in proteins. Mono-ADP-ribosylation is a posttranslational modification of proteins that is interfered with by a variety of bacterial toxins including cholera, pertussis, and heat-labile enterotoxins of E. coli. ART4 could be detected on HEL cells and erythrocytes by FACS analysis while it was absent from activated monocytes, despite the presence of ART4 mRNA in these cells. ART is also known as the carrier of the Dombrock blood group alloantigens (Do) which is glycosylphosphatidylinosotol-anchored to the erythrocyte membrane.

References
  • Parusel I, et al. (2005) A panel of monoclonal antibodies recognizing GPI-anchored ADP-ribosyltransferase ART4, the carrier of the Dombrock blood group antigens. Cell Immunol. 236(1-2): 59-65.
  • Friedrich M, et al. (2005) Analysis of the 3' UTR of the ART3 and ART4 gene by 3' inverse RACE-PCR. DNA Seq. 16(1): 53-7.
  • Okazaki IJ, et al. (1998) Glycosylphosphatidylinositol-anchored and secretory isoforms of mono-ADP-ribosyltransferases. J Biol Chem. 273(37): 23617-20.
  • Size / Price
    Catalog: CG90272-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"