After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Dectin-1 / CLEC7A transcript variant 2 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CLEC7A cDNA Clone Product Information
NCBI RefSeq:NM_022570.4
RefSeq ORF Size:606bp
cDNA Description:Full length Clone DNA of Homo sapiens C-type lectin domain family 7, member A (CLEC7A), transcript variant 2 with C terminal Myc tag.
Gene Synonym:CLEC7A, BGR, CLECSF12, DECTIN1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:pCMV3-CLEC7A-Myc
Restriction Site:HindIII + XbaI (6kb + 0.65kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 462 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CLEC7A Gene Plasmid Map
Human Dectin-1 / CLEC7A transcript variant 2 ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Dectin-1 was recently identified as the most important receptor for beta-glucan. It is a type II transmembrane protein which binds beta-1,3 and beta-1,6 glucans, and is expressed on most cells of the innate immune system and has been implicated in phagocytosis as well as killing of fungi by macrophages, neutrophils and dendritic cells. Recognition of beta-glucan by dectin-1 triggers effective immune response, including phagocytosis and proinflammatory factor production, to eliminate infecting fungi, which especially benefits immunocompromised patients against opportunistic fungal infection. In addition, dectin-1 is involved in the adaptive immune response as well as autoimmune diseases and immune tolerance. Dectin-1 can recognize and respond to live fungal pathogens and is being increasingly appreciated as having a key role in the innate responses to these pathogens. In addition to its exogenous ligands, Dectin-1 can recognize an unidentified endogenous ligand on T cells and may act as a co-stimulatory molecule. Recent studies have highlighted the importance of Dectin-1 in anti-fungal immunity, in both mice and humans, and have suggested a possible involvement of this receptor in the control of mycobacterial infections.

References
  • Herre J, et al. (2004) The role of Dectin-1 in antifungal immunity. Crit Rev Immunol. 24(3): 193-203.
  • Brown GD. (2006) Dectin-1: a signalling non-TLR pattern-recognition receptor. 6(1): 33-43.
  • Sun L, et al. (2007) The biological role of dectin-1 in immune response. Int Rev Immunol. 26(5-6): 349-64.
  • Schorey JS, et al. (2008) The pattern recognition receptor Dectin-1: from fungi to mycobacteria. Curr Drug Targets. 9(2): 123-9.
  • Reid DM, et al. (2009) Pattern recognition: recent insights from Dectin-1. Curr Opin Immunol. 21(1): 30-7.
  • Size / Price
    Catalog: HG10215-CM
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"