After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human CD209 / DC-SIGN Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD209cDNA Clone Product Information
cDNA Size:1215
cDNA Description:ORF Clone of Homo sapiens CD209 molecule DNA.
Gene Synonym:CD209, CDSIGN, CLEC4L, DC-SIGN, DC-SIGN1, MGC129965
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Dendritic cell (DC)-specific intercellular adhesion molecule 3 (ICAM-3) grabbing nonintegrin (DC-SIGN), also known as CD209, is a type II transmembrane protein on DCs with a C-type lectin extracellular domain, is capable of binding ICAM-3 on resting T cells in the secondary lymphoid organs, providing the initial contact between these cells during the establishment of cell-mediated immunity. It is not only a pattern recognition receptor but implicated in immunoregulation of DCs. It has important role in mediating DC adhesion, migration, inflammation, activating primary T cell, triggering immune response and participating in immune escape of pathogens and tumors. DC-SIGN also mediates capture and internalization of viral, bacterial, and fungal pathogens by dendritic cells, such as HIV-1, Ebola virus, cytomegalovirus, Dengue virus, and hepatitis C virus. DC-SIGN is unique in that it regulates adhesion processes, such as DC trafficking and T-cell synapse formation, as well as antigen capture. Moreover, even though several C-type lectins have been shown to bind HIV-1, DC-SIGN does not only capture HIV-1 but also protects it in early endosomes allowing HIV-1 transport by DC to lymphoid tissues, where it enhances trans infection of T cells.

  • Geijtenbeek TB, et al. (2002) DC-SIGN, a C-type lectin on dendritic cells that unveils many aspects of dendritic cell biology. J Leukoc Biol. 71(6): 921-31.
  • Masso M. (2003) DC-SIGN points the way to a novel mechanism for HIV-1 transmission. MedGenMed. 5(2): 2.
  • Zhou T, et al. (2006) DC-SIGN and immunoregulation. Cell Mol Immunol. 3(4): 279-83.