After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey BTLA ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus BTLA cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:870bp
cDNA Description:Full length Clone DNA of Macaca mulatta b- and T-lymphocyte attenuator-like with N terminal Myc tag.
Gene Synonym:BTLA
Species:Cynomolgus
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

BTLA is a inhibitory molecule which belongs to the Ig superfamily. It down-modulates immune responses. As such, reagents that regulate the binding of BTLA to its ligand or alter BTLA signaling have significant therapeutic promise. BTLA is crucial to understand the mechanism(s) of action of these antibodies before attempting clinical applications. BTLA is not expressed by naive T cells, but it is induced during activation and remains expressed on T helper type 1 (T(H)1) but not T(H)2 cells. BTLA is a third inhibitory receptor on T lymphocytes with similarities to cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) and programmed death 1 (PD-1).

References
  • Fourcade J, et al. (2012) CD8(+) T cells specific for tumor antigens can be rendered dysfunctional by the tumor microenvironment through upregulation of the inhibitory receptors BTLA and PD-1. Cancer Res. 72(4):887-96.
  • Kojima R, et al. (2011) Molecular basis for herpesvirus entry mediator recognition by the human immune inhibitory receptor CD160 and its relationship to the cosignaling molecules BTLA and LIGHT. J Mol Biol. 413(4):762-72.
  • Oki M, et al. (2011) A functional polymorphism in B and T lymphocyte attenuator is associated with susceptibility to rheumatoid arthritis. Clin Dev Immunol. 305656.
  • Size / Price
    Catalog: CG90250-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"