Quick Order

Human COMP / THBS5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
COMPcDNA Clone Product Information
cDNA Size:2274
cDNA Description:ORF Clone of Homo sapiens cartilage oligomeric matrix protein DNA.
Gene Synonym:COMP, MED, EDM1, EPD1, PSACH, THBS5, MGC131819, MGC149768
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Cartilage Oligomeric Matrix Protein (COMP), also referred to as Thrombospondin-5, is a non-collagenous extracellular matrix (ECM) protein and belongs to the subgroup B of the thrombospondin protein family. This protein is expressed primarily in cartilage, ligament, and tendon, and binds to other ECM proteins such as collagen I, II and IX with high affinities depending on the divalent cations Zn2+ or Ni2+. COMP is a secreted glycoprotein that is important for growth plate organization and function. It is suggested to play a role in cell growth and development, and recent studies have revealed the possible mechanism that it protects cells against death by elevating members of the IAP (inhibitor of apoptosis protein) family of survival proteins. Mutations in COMP cause two skeletal dysplasias, pseudoachondroplasia (PSACH) and multiple epiphyseal dysplasia (EDM1), and up-regulated expression of COMP are observed in rheumatoid arthritis and certain carcinomas.

  • Posey KL, et al. (2004) Role of TSP-5/COMP in pseudoachondroplasia. Int J Biochem Cell Biol. 36(6): 1005-12.
  • Chen FH, et al. (2005) Interaction of cartilage oligomeric matrix protein/thrombospondin 5 with aggrecan. J Biol Chem. 282(34): 24591-8.
  • Posey KL, et al. (2008) The role of cartilage oligomeric matrix protein (COMP) in skeletal disease. Curr Drug Targets. 9(10): 869-77.
  • Tan K, et al. (2009) The crystal structure of the signature domain of cartilage oligomeric matrix protein: implications for collagen, glycosaminoglycan and integrin binding. FASEB J. 23(8): 2490-501.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items