Quick Order

Text Size:AAA

Human Dkk1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DKK1 cDNA Clone Product Information
Gene_bank_ref_id:NM_012242.2
RefSeq ORF Size:795bp
cDNA Description:Full length Clone DNA of Homo sapiens dickkopf homolog 1 (Xenopus laevis) with C terminal Myc tag.
Gene Synonym:SK, DKK-1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:pCMV3-DKK1-Myc
Restriction Site:KpnI + XbaI (6kb + 0.85kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Dickkopf (DKK) family proteins, consisting of DKK-1, DKK-2, DKK-3 and DKK-4, function as secreted Wnt antagonists by inhibiting Wnt coreceptors LRP5/6. DKK-1, DKK-2, and DKK-4 also bind cell surface Kremen-1 or Kremen-2 and promote the internalization of LRP5/6. Dickkopf related protein 1 (DKK-1) was initially identified as an inducer of head formation in Xenopus embryos. DKK-1 protein modulates Wnt signaling pathway during embryonic development. Increased levels of DKK-1 are found in the majority of lung cancers, esophageal squamous cell carcinomas, and hormone-resistant breast cancers, while DKK-1 expression is decreased in malignant melanoma and colorectal cancers.

References
  • Horwitz EM. (2004) Dkk-1-mediated expansion of adult stem cells. Trends Biotechnol. 22(8): 386-8.
  • Jiang T, et al. (2009) Clinical significance of serum DKK-1 in patients with gynecological cancer. Int J Gynecol Cancer. 19(7): 1177-81.
  • Size / Price
    Catalog: HG10170-CM
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"