After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human C2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
C2cDNA Clone Product Information
cDNA Size:2259
cDNA Description:ORF Clone of Homo sapiens complement component 2 DNA.
Gene Synonym:C2, CO2, DKFZp779M0311
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Complement component C2 is part of the classical complement pathway which plays a major role in innate immunity against infection. C2 is a glycoprotein synthesized in liver hepatocytes and several other cell types in extrahepatic tissues. This pathway is triggered by a multimolecular complex C1, and subsequently the single-chain form of C2 is cleaved into two chains referred to C2a and C2b by activated C1. The second component of complement (C2) is a multi-domain serine protease that provides catalytic activity for the C3 and C5 convertases of the classical and lectin pathways of human complement. C4b and C2 was investigated by surface plasmon resonance. C2a containing a serine protease domain combines with complement component C4b to form the C3 convertase C4b2a which is responsible for C3 activation, and leads to the stimulation of adaptive immune responses via Lectin pathway. C2 bound to C4b is cleaved by classical (C1s) or lectin (MASP2) proteases to produce C4bC2a. C2 has the same serine protease domain as C4bC2a but in an inactive zymogen-like conformation, requiring cofactor-induced conformational change for activity. Deficiency of C2 (C2D) is the most common genetic deficiency of the complement system, and two types of C2D have been recognized in the context of specific MHC haplotypes. C2D in human is reported to increase susceptibility to infection, and is associated with certain autoimmune diseases, such as rheumatological disorders.

  • Laich A, et al. (2002) Complement C4bC2 complex formation: an investigation by surface plasmon resonance. Biochim Biophys Acta. 1544(1-2): 96-112.
  • Halili MA, et al. (2009) Complement component C2, inhibiting a latent serine protease in the classical pathway of complement activation. Biochemistry. 48(35): 8466-72.
  • Krishnan V, et al. (2009) The structure of C2b, a fragment of complement component C2 produced during C3 convertase formation. Acta Crystallogr D Biol Crystallogr. 65(Pt 3): 266-74.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items