Quick Order

Human CHL-1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged, expression ready

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CHL1cDNA Clone Product Information
cDNA Size:3675
cDNA Description:ORF Clone of Homo sapiens CHL1 cell adhesion molecule with homology to L1CAM (close homolog of L1) DNA.
Gene Synonym:CHL1, CALL, L1CAM2, FLJ44930, MGC132578
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CHL-1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged, expression ready on other vectors
Related Products
Product nameProduct name

Neural cell adhesion molecule L1-like protein, also known as close homolog of L1 (CHL1) is the prototypic member of the CTF / NF-1 family of transcription factors that serve as a novel calcium signaling pathway-responsive transcription factor and is considered as a member of the largest ctf complementation group, consisting of 30 of 126 ctf mutants isolated. CHL1 is a cell adhesion molecule highly related to L1. It contains structure plan of six extracellular C2-type immunoglobulin (Ig) domains followed by five fibronectin typeⅢ domains linked by a single membrane-spanning region to a short cytoplasmic domain. The extracellular portion of CHL1 is higyly glycosylated and involved them in hemophilic disease.

  • Alevizopoulos A, et al. (1997) Regulation of the Transforming Growth Factor beta-responsive Transcription Factor CTF-1 by Calcineurin and Calcium/ Calmodulin-dependent Protein Kinase IV. The Journal of Biological Chemistry. 272: 23597-605.
  • Gerring SL, et al. (1990) The CHL1 (CTF 1) gene product of Saccharomyces cerevisiae is important for chromosome transmission and normal cell cycle progression in G2 / M. EMBO J. 9 (13): 4347-58.
  • Wei MH, et al. (1998) In silico-initiated cloning and molecular characterization of a novel human member of the L1 gene family of neural cell adhesion molecules. Human Genetics. 103 (3): 355-64.