After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PIGR ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PIGR cDNA Clone Product Information
Gene_bank_ref_id:NM_002644.2
RefSeq ORF Size:2295bp
cDNA Description:Full length Clone DNA of Homo sapiens polymeric immunoglobulin receptor with C terminal Myc tag.
Gene Synonym:PIGR, FLJ22667, MGC125361, MGC125362
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Polymeric immunoglobulin receptor, also known as PIGR, is a member of the immunoglobulin superfamily and a Fc receptor. The ectodomain of this receptor consists of five units with homology to the variable units of immunoglobulins and a transmembrane region, which also has some homology to certain immunoglobulin variable regions. PIGR is expressed on several glandular epithelia including those of liver and breast. The deduced amino-acid sequence has a length of 764 residues and shows an overall similarity of 56% and 64% with the rabbit and rat counterpart. PIGR mediates transcellular transport of polymeric immunoglobulin molecules, and thus facilitates the secretion of IgA and IgM. During this process, a cleavage occurs that separates the extracellular (known as the secretory component) from the transmembrane segment of PIGR.

References
  • Coyne, R. S. et al., 1995, J. Biol. Chem. 269 (50) :31620-31625. 
  • Kaetzel,C.S., 2001,  Curr Biol. 11(1): R35-38.
  • Size / Price
    Catalog: HG10131-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"