After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CD146 / MCAM Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MCAMcDNA Clone Product Information
cDNA Size:1941
cDNA Description:ORF Clone of Homo sapiens melanoma cell adhesion molecule DNA.
Gene Synonym:MCAM, CD146, MUC18
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CD146 / MCAM Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Related Products
Product nameProduct name

The CD146 antigen, also known as melanoma cell adhesion molecule (MCAM) and MUC18, is an integral membrane glycoprotein belonging to the immunoglobulin superfamily. CD146 contains the characteristic immunoglobulin-like domains (V-V-C2-C2-C2), a transmembrane region and a short cytoplasmic tail. The CD146 expression is detected in endothelial cells in vascular tissue throughout the body, and plays a role in cell adhesion, as well as in cohesion of the endothelial monolayer at intercellular junctions in vascular tissue. As a Ca2+-independent cell adhesion molecule involved in heterophilic cell to cell interactions and a surface receptor, CD146 triggers tyrosine phosphorylation of FYN and PTK2 and subsequently induced signal transduction, proteolysis, or immune recognition. This protein is also expressed predominantly on metastatic lesions and advanced primary tumours, and thus has been suggested to play an important role in tumour progression and the development of metastasis in certain human carcinomas.

  • Mills L, et al. (2002) Fully human antibodies to MCAM/MUC18 inhibit tumor growth and metastasis of human melanoma. Cancer Res. 62(17): 5106-14.
  • Taira E, et al. (2004) Characterization of Gicerin/MUC18/CD146 in the rat nervous system. J Cell Physiol. 198(3): 377-87.
  • Fritzsche FR, et al. (2008) CD146 protein in prostate cancer: revisited with two different antibodies. Pathology. 40(5): 457-64.
  • Bidlingmaier S, et al. (2009) Identification of MCAM/CD146 as the target antigen of a human monoclonal antibody that recognizes both epithelioid and sarcomatoid types of mesothelioma. Cancer Res. 69(4): 1570-7.
  • Boneberg EM, et al. (2009) Soluble CD146 is generated by ectodomain shedding of membrane CD146 in a calcium-induced, matrix metalloprotease-dependent process. Microvasc Res. 78(3): 325-31.