Quick Order

Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DUSP3cDNA Clone Product Information
cDNA Size:558
cDNA Description:ORF Clone of Homo sapiens dual specificity phosphatase 3 DNA.
Gene Synonym:DUSP3, VHR
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10114-ACG$325
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10114-ACR$325
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10114-ANG$325
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10114-ANR$325
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10114-CF$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10114-CH$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10114-CM$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10114-CY$295
Human VHR Gene cDNA Clone (full-length ORF Clone)HG10114-M$95
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10114-M-F$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10114-M-N$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10114-NF$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10114-NH$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10114-NM$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10114-NY$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10114-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Vaccinia H1-related phosphatase (VHR) is classified as a dual-specificity phosphatase (DUSP), and the other name is dual-specificity phosphatase 3 (DUSP3). DUSPs are a heterogeneous group of protein phosphatases that can dephosphorylate both phosphotyrosine and phosphoserine/phosphothreonine residues within the one substrate. Unlike typical DUSPs, VHR lacks mitogen-activated protein kinase (MAPK)-binding domain, and shows poor activity against MAPKs. VHR often act on bisphosphorylated protein substrates, it displays a strong preference for dephosphorylating phosphotyrosine residues over phosphothreonine residues. VHR has been identified as a novel regulator of extracellular regulated kinases (ERKs). VHR is responsible for the rapid inactivation of ERK following stimulation and for its repression in quiescent cells. VHR is a negative regulator of the Erk and Jnk pathways in T cells and, therefore, may play a role in aspects of T lymphocyte physiology that depend on these kinases.

  • Todd J.L, et al. (1999) Extracellular regulated kinases (ERK) 1 and ERK2 are authentic substrates for the dual-specificity protein-tyrosine phosphatase VHR. A novel role in down-regulating the ERK pathway. J. Biol. Chem. 274: 13271-80.
  • Alonso A, et al. (2001) Inhibitory role for dual specificity phosphatase VHR in T cell antigen receptor and CD28-induced Erk and Jnk activation. J Biol Chem. 276(7): 4766-71.
  • Schumacher MA, et al. (2002) Structural basis for the recognition of a bisphosphorylated MAP kinase peptide by human VHR protein Phosphatase. Biochemistry. 41(9): 3009-17.
  • Patterson KI, et al. (2009) Dual-specificity phosphatases: critical regulators with diverse cellular targets. Biochem J. 2009 Mar 15;418(3): 475-89.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items