Quick Order

Cynomolgus monkey CD1B ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus CD1B cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:1002bp
cDNA Description:Full length Clone DNA of Macaca mulatta CD1b molecule with N terminal Myc tag.
Gene Synonym:CD1B
Species:Cynomolgus
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CD1B contains 1 Ig-like (immunoglobulin-like) domain and belongs to the CD1 family. CD1 family members are transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. During protein synthesis and maturation, they bind endogenous lipids that are replaced by lipid or glycolipid antigens when the proteins are internalized and pass through endosomes, before trafficking back to the cell surface. CD1B localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail, and requires vesicular acidification to bind lipid antigens.. It is expressed on cortical thymocytes, epidermal Langerhans cells, dendritic cells, on certain T-cell leukemias, and in various other tissues. CD1B is an antigen-presenting protein that binds self and non-self lipid and glycolipid antigens and presents them to T-cell receptors on natural killer T-cells.

References
  • Coventry B, et al. (2004) CD1a in human cancers: a new role for an old molecule. Trends Immunol. 25 (5):242-8.
  • Martin LH, et al. (1988) Structure and expression of the human thymocyte antigens CD1a, CD1b, and CD1c. Proc Natl Acad Sci. 84(24):9189-93.
  • Aruffo A, et al. (1989) Expression of cDNA clones encoding the thymocyte antigens CD1a, b, c demonstrates a hierarchy of exclusion in fibroblasts. J Immunol. 143(5):1723-30.
  • Longley J, et al. (1989) Molecular cloning of CD1a (T6), a human epidermal dendritic cell marker related to class I MHC molecules. J Invest Dermatol. 92(4):628-31.
  • Size / Price
    Catalog: CG90173-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"