After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey REG1B Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
REG1BcDNA Clone Product Information
cDNA Size:501
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) regenerating islet-derived 1 beta DNA.
Gene Synonym:REG1B
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Regenerating gene (Reg), first isolated from a regenerating islet cDNA library, encodes a secretory protein with a growth stimulating effect on pancreatic beta cells, and could be associated with fibrocalculous pancreatopathy. Reg and Reg-related genes which were expressed in various organs have been revealed to constitute a multigene family, the Reg family consisting of four subtypes (types I, II, III, IV) and are involved in cancers and neurodegenerative diseases. Regenerating islet-derived 1 beta (REG1B), also known as Lithostathine-1-beta and Pancreatic stone protein 2 (PSPS2), is a types I Reg protein and contains one typical C-type lectin domain. REG1B is a 166-amino acid protein which has 22 amino acid substitutions in comparison with the previously isolated human REG1A, and it is was expressed only in pancreas. REG1B Is normally found in the exocrine pancreas, whereas in other tissues it appears either only under pathological conditions, such as Alzheimer's disease (brain), cancer (colon), or during regeneration such as neuronal sprouting in brain and pancreas regeneration. REG1B might act as an inhibitor of spontaneous calcium carbonate precipitation. The REG1A and REG1B gene and proteins could play different roles in the pancreas.

  • Moriizumi S, et al. (1994) Isolation, structural determination and expression of a novel reg gene, human regI beta. Biochim Biophys Acta. 1217(2): 199-202.
  • Sanchez D, et al. (2001) Preferential expression of reg I beta gene in human adult pancreas. Biochem Biophys Res Commun. 284(3): 729-37.
  • Boonyasrisawat W, et al. (2002) Analysis of the reg1alpha and reg1beta gene transcripts in patients with fibrocalculous pancreatopathy. Southeast Asian J Trop Med Public Health. 33(2): 365-72.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks