Quick Order

Human S6K / RPS6KB1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RPS6KB1 cDNA Clone Product Information
Gene_bank_ref_id:NM_003161.2
RefSeq ORF Size:1578bp
cDNA Description:Full length Clone DNA of Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1 with C terminal Myc tag.
Gene Synonym:RPS6KB1, S6K, PS6K, S6K1, STK14A, p70-S6K, p70-alpha, p70(S6K)-alpha
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

PS6K, also known as RPS6KB1, is a serine/threonine-protein kinase. It belongs to the RSK (ribosomal s6 kinase) family. Members of this family function in signal transduction. PS6K is an isoform of p70 ribosomal S6 kinase (S6K). S6K can be activated by mitogenic stimuli such as growth factors, insulin and cytokines. It phosphorylates the ribosomal protein S6. PS6K also phosphorylates other proteins such as elF4B, eEF2K and SKAR. It is a crucial effector of mTOR(rapamycin) signaling. PS6K is dissociated from the EIF3 complex and activated upon mitogenic stimulation, phosphorylation by the mammalian target of mTOR complex 1 (mTORC1). Its active form then phosphorylates and activates several substrates in the preinitiation complex, including the EIF2B complex and the cap-binding complex component EIF4B. PS6K also functions in cell proliferation, cell growth and cell cycle progression.

References
  • Panasyuk, et al. (2006) Nuclear export of PS6K II is regulated by protein kinase CK2 phosphorylation at Ser-17. J Biol Chem. 281(42):31188-201.
  • Carnevalli L, et al. (2010) PS6K Plays a Critical Role in Early Adipocyte Differentiation. Dev Cell. 18 (5):763-74.
  • Grove JR, et al. (1991) Cloning and expression of two human p70 S6 kinase polypeptides differing only at their amino termini. Mol Cell Biol. 11(11):5541-50.
  • Size / Price
    Catalog: HG10099-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"