After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BDNFcDNA Clone Product Information
cDNA Size:744
cDNA Description:ORF Clone of Homo sapiens brain-derived neurotrophic factor (BDNF), transcript variant 4 DNA.
Gene Synonym:BDNF, MGC34632
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10068-ACG$325
Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10068-ACR$325
Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10068-ANG$325
Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10068-ANR$325
Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10068-CF$295
Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10068-CH$295
Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10068-CM$295
Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10068-CY$295
Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone)HG10068-M$95
Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10068-M-N$295
Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10068-NF$295
Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10068-NH$295
Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10068-NM$295
Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10068-NY$295
Human BDNF transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10068-UT$295
 Learn more about expression Vectors
Neurotrophin & Receptor Related Products

BDNF is a member of the nerve growth factor family. It is highly expressed in hippocampus, amygdala, cerebral cortex and cerebellum. It also can be detected in heart, lung, skeletal muscle, testis, prostate and placenta. BDNF is induced by cortical neurons, and is necessary for survival of striatal neurons in the brain. During development, BDNF promotes the survival and differentiation of selected neuronal populations of the peripheral and central nervous systems. It participates in axonal growth, pathfinding and in the modulation of dendritic growth and morphology. It functions as the major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability.

  • Zigova T, et al. (1998) Intraventricular administration of BDNF increases the number of newly generated neurons in the adult olfactory bulb. Mol Cell Neurosci. 11(4):234-45.
  • Acheson A, et al. (1995) A BDNF autocrine loop in adult sensory neurons prevents cell death. Nature 374(6521):450-3.
  • Bekinschtein P, et al. (2008) BDNF is essential to promote persistence of long-term memory storage. Proc Natl Acad Sci. 105(7):2711-6.