After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Cynomolgus monkey CCL24 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCL24cDNA Clone Product Information
cDNA Size:360
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) chemokine (C-C motif) ligand 24 DNA.
Gene Synonym:CCL24
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Chemokine & Receptor Related Products
Product nameProduct name

CCL24, also known as Eotaxin-2 and MPIF-2, belongs to the intercrine beta (chemokine CC) family. CCL24 gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. CCL24 displays chemotactic activity on resting T lymphocytes, a minimal activity on neutrophils, and is negative on monocytes and activated T lymphocytes. CCL24 is also a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. CCL24 is chemotactic for resting T-lymphocytes, and eosinophils. It has lower chemotactic activity for neutrophils but none for monocytes and activated lymphocytes. It is a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. Eotaxin-2 interacts with chemokine receptor CCR3 to induce chemotaxis in eosinophils. Elevated level of Eotaxin-2 has been seen in patients with aspirin-exacerbated respiratory disease.

  • Manousou P, et al. (2010) Increased expression of chemokine receptor CCR3 and its ligands in ulcerative colitis: the role of colonic epithelial cells in in vitro studies. Clin Exp Immunol. 162 (2): 337-47.
  • Owczarek W, et al. (2010) Analysis of eotaxin 1/CCL11, eotaxin 2/CCL24 and eotaxin 3/CCL26 expression in lesional and non-lesional skin of patients with atopic dermatitis. Cytokine. 50 (2): 181-5.
  • Luesink M, et al. (2009) Chemokine induction by all-trans retinoic acid and arsenic trioxide in acute promyelocytic leukemia: triggering the differentiation syndrome. Blood. 114 (27): 5512-21.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items