Quick Order

Text Size:AAA

Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GSK3BcDNA Clone Product Information
Gene_bank_ref_id:NM_001146156.1
cDNA Size:1263
cDNA Description:ORF Clone of Homo sapiens glycogen synthase kinase 3 beta DNA.
Gene Synonym:GSK3B
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10044-ACG$325
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10044-ACR$325
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10044-ANG$325
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10044-ANR$325
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10044-CF$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10044-CH$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10044-CM$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10044-CY$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone)HG10044-M$195
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10044-NF$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10044-NH$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10044-NM$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10044-NY$295
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10044-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

GSK3B is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It Contains 1 protein kinase domain, and is expressed in testis, thymus, prostate and ovary and weakly expressed in lung, brain and kidney. GSK3B is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in GSK3B gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. GSK3B participates in the Wnt signaling pathway. It is implicated in the hormonal control of several regulatory proteins including glycogen synthase, MYB and the transcription factor JUN. Phosphorylates JUN at sites proximal to its DNA-binding domain, thereby reducing its affinity for DNA. Phosphorylates MUC1 in breast cancer cells, and decreases the interaction of MUC1 with CTNNB1/beta-catenin. GSK3B also plays an important role in ERBB2-dependent stabilization of microtubules at the cell cortex. It prevents the phosphorylation of APC and CLASP2, allowing its association with the cell membrane. In turn, membrane-bound APC allows the localization of MACF1 to the cell membrane, which is required for microtubule capture and stabilization. GSK3B phosphorylates MACF1 and this phosphorylation inhibits the binding of MACF1 to microtubules which is critical for its role in bulge stem cell migration and skin wound repair. It may be required for early embryo development and neuron differentiation.

References
  • Bergmann C, et al. (2011) Inhibition of glycogen synthase kinase 3β induces dermal fibrosis by activation of the canonical Wnt pathway. Ann Rheum Dis. 70(12):2191-8.
  • Ban JO, et al. (2011) Troglitazone, a PPAR agonist, inhibits human prostate cancer cell growth through inactivation of NFκB via suppression of GSK-3β expression. Cancer Biol Ther. 12(4):288-96.
  • Tsukigi M, et al. (2012) Re-expression of miR-199a suppresses renal cancer cell proliferation and survival by targeting GSK-3β. Cancer Lett. 315(2):189-97.
  • Nandan D, et al. (2012) Myeloid cell IL-10 production in response to leishmania involves inactivation of glycogen synthase kinase-3β downstream of phosphatidylinositol-3 kinase. J Immunol. 188(1):367-78.
  • Size / Price
    Catalog:HG10044-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"