Quick Order

Ferret CTSE ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Ferret CTSE cDNA Clone Product Information
Gene_bank_ref_id:XM_004788303.1
RefSeq ORF Size:1194bp
cDNA Description:Full length Clone DNA of Mustela putorius furo (sub-species: furo) cathepsin E with C terminal Myc tag.
Gene Synonym:CTSE
Species:Ferret
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Cathepsin E Protein (CTSE Protein) is a member of the peptidase C1 family that is a gastric aspartic protease that functions as a disulfide-linked homodimer. Cathepsin E Protein (CTSE Protein) is predominantly present in the cells of immune system and is frequently implicated in antigen processing via the MHC classⅡ pathway which however does not appear to be involved in the digestion of dietary protein. The protein has a specificity similar to that of pepsin and pepsin. Cathepsin E Protein (CTSE Protein) is found in highest concentration in the surface of epithelial mucus-producing cells of the stomach and also been found in more than half of the gastric cancers. It appears, therefore, to be an oncofetal antigen.

References
  • Zaidi N, et al. (2008) Emerging functional foles of cathepsin E. Biochem Biophys Res Commun. 377(2) : 327-30.
  • Zaidi N, et al. (2008) Cathepsin E: a mini review. Biochem Biophys Res Commun. 367(3) :517-22.
  • Azuma T, et al. (1989) Human gastric cathepsin E Predicted sequence, localization to chromosome 1, and sequence homology with other aspartic proteinases.The journal of biological chemistry. 264: 16748-53.
  • Size / Price
    Catalog: FG60148-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"