Quick Order

Text Size:AAA

Cynomolgus monkey IGFBP2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IGFBP2cDNA Clone Product Information
cDNA Size:981
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) insulin-like growth factor binding protein 2 DNA.
Gene Synonym:IGFBP2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.


IGFBP-2, also known as IGFBP2, is a insulin-like growth factor-binding protein (IGFBP). IGFBPs prolong the half-life of the IGFs , control bioavailability, activity, and distribution of insulin-like growth factor (IGF) through high-affinity IGFBP/IGF complexes. Six high-affinity IGF-binding proteins (IGFBP-1 to -6) have been identified. The six IGFBPs are structurally related but encoded by distinct genes. IGFBPs have a high affinity for IGFs. Some members of the IGFBP family have been consistently shown to inhibit IGF actions by preventing them from gaining access to the IGF receptors, while others potentiate IGF actions by facilitating the ligand-receptor interaction. IGFBP-2 is overexpressed in many malignancies and is often correlated with an increasingly malignant status of the tumor, pointing to a potential involvement of IGFBP-2 in tumorigenesis. It contains 1 IGFBP N-terminal domain and 1 thyroglobulin type-1 domain. It inhibits IGF-mediated growth and developmental rates.

  • Han VK, et al. (1996) The expression of insulin-like growth factor (IGF) and IGF-binding protein (IGFBP) genes in the human placenta and membranes: evidence for IGF-IGFBP interactions at the feto-maternal interface. J Clin Endocrinol Metab. 81(7): 2680-93.
  • Binkert C, et al. (1989) Cloning, sequence analysis and expression of a cDNA encoding a novel insulin-like growth factor binding protein (IGFBP-2) . EMBO J. 8(9):2497-502.
  • Wolf E, et al. (2000) Effects of IGFBP-2 overexpression in vitro and in vivo. Pediatr Nephrol. 14 (7):572-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items