Quick Order

Text Size:AAA

Cynomolgus monkey CCL17 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus CCL17 cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:285bp
cDNA Description:Full length Clone DNA of Macaca mulatta chemokine (C-C motif) ligand 17 with N terminal Myc tag.
Gene Synonym:CCL17
Species:Cynomolgus
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Background

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokin ligand 17 (CCL17), also known as thymus and activation regulated chemokine(TARC), is a small cytokine belonging to the C-C chemokine family. CCL17 is expressed maily in thymus and transiently in phytohemagglutinin-stimulated peripheral blood mononuclear cells. CCL17 can induce chemotaxis in T cells by binding with the chemokine receptor CCR4.

References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811-5.
  • Morita A, et al. (2002). Evaluation of human thymus and activation-regulated chemokine concentrations in blood using a new sandwich ELISA based on monoclonal antibodies. Clin Chim Acta. 322 (1-2): 67-75.
  • Size / Price
    Catalog: CG90077-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"