Quick Order

Text Size:AAA

Cynomolgus monkey BMPR2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BMPR2cDNA Clone Product Information
cDNA Size:3117
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) bone morphogenetic protein receptor, type II (serine/threonine kinase) DNA.
Gene Synonym:BMPR2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Transforming Growth Factor Beta (TGF-beta) Family Related Products
Product nameProduct name
Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Human ALK-2 / ACVR1 Protein (His & Fc Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human TGFBR2 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Human ALK4 / ACVR1B Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinHuman BAMBI / NMA Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human ATF2 Protein (His & GST Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Mouse Smad5 ProteinMouse BAMBI / NMA Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rat Cripto / TDGF1 Protein (Fc Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Cynomolgus TGFBR2 Protein (Fc Tag)Cynomolgus ACVR1B / ALK-4 Protein (Fc Tag)Cynomolgus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)

The bone morphogenetic protein type II receptor (BMPR-II, or BMPR2), a receptor for the transforming growth factor (TGF)-beta/bone morphogenetic protein (BMP) superfamily. Reduced expression or function of BMPR2 signaling leads to exaggerated TGF-beta signaling and altered cellular responses to TGF-beta. In endothelial cells, BMPR2 mutation increases the susceptibility of cells to apoptosis. BMPR2 transduces BMP signals by forming heteromeric complexes with and phosphorylating BMP type I receptors. The intracellular domain of BMPR2 is both necessary and sufficient for receptor complex interaction. It had been identified that BMPR2 plays a key role in cell growth. Its mutations lead to hereditary pulmonary hypertension, and knockout of Bmpr-II results in early embryonic lethality. The C-terminal tail of BMPR2 provides binding sites for a number of regulatory proteins that may initiate Smad-independent signalling. BMPR2 mutations were predicted to alter the BMP and TGF-b1/SMAD signalling pathways, resulting in proliferation rather than apoptosis of vascular cells, and greatly increase the risk of developing severe pulmonary arterial hypertension. BMPR2 gene result in familial Primary pulmonary hypertension (PPH) transmitted as an autosomal dominant trait, albeit with low penetrance. Heterozygous germline mutations of BMPR2 gene have been identified in patients with familial and sporadic PPH, indicating that BMPR2 may contribute to the maintenance of normal pulmonary vascular structure and function. Tctex-1, a light chain of the motor complex dynein, interacts with the cytoplasmic domain of BMPR2 and demonstrate that Tctex-1 is phosphorylated by BMPR-II, a function disrupted by PPH disease causing mutations within exon 12. BMPR2 and Tctex-1 co-localize to endothelium and smooth muscle within the media of pulmonary arterioles, key sites of vascular remodelling in PPH.

  • Machado RD, et al. (2003) Functional interaction between BMPR-II and Tctex-1, a light chain of Dynein, is isoform-specific and disrupted by mutations underlying primary pulmonary hypertension. Hum Mol Genet. 12(24): 3277-86.
  • Abramowicz MJ, et al. (2003) Primary pulmonary hypertension after amfepramone (diethylpropion) with BMPR2 mutation. Eur Respir J. 22(3): 560-2.
  • Hassel S, et al. (2004) Proteins associated with type II bone morphogenetic protein receptor (BMPR-II) and identified by two-dimensional gel electrophoresis and mass spectrometry. Proteomics. 4(5): 1346-58.
  • Beppu H, et al. (2005) Generation of a floxed allele of the mouse BMP type II receptor gene. Genesis. 41(3): 133-7.
  • Morrell NW. (2006) Pulmonary hypertension due to BMPR2 mutation: a new paradigm for tissue remodeling? Proc Am Thorac Soc. 3(8): 680-6.
  • Nasim MT, et al. (2008) Stoichiometric imbalance in the receptor complex contributes to dysfunctional BMPR-II mediated signalling in pulmonary arterial hypertension. Hum Mol Genet. 217(11): 1683-94.

    BMPR2 related areas, pathways, and other information

    Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items