Quick Order

Rhesus HFE2 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus HFE2 cDNA Clone Product Information
NCBI RefSeq:XM_001093102.2
RefSeq ORF Size:1284bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) hemochromatosis type 2 (juvenile) with N terminal Myc tag.
Gene Synonym:HFE2
Species:Rhesus
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Hemojuvelin, also known as HFE2, is a membrane-bound and soluble protein which belongs to the repulsive guidance molecule (RGM) family. It is known that RGMs function through Neogenin, a homologue of the Netrin receptor deleted in colon cancer. In mammals, RGM family consists of three glycoproteins which have discrete expression patterns and functions (RGM-A, RGM-B, and RGM-C). Hemojuvelin is expressed in adult and fetal liver, heart, and skeletal muscle. Hemojuvelin acts as a bone morphogenetic protein (BMP) coreceptor. Enhancement of BMP signaling regulates hepcidin (HAMP) expression and iron metabolism. It plays a key role in iron metabolism. Hemojuvelin represents the cellular receptor for hepcidin. It may be a component of the signaling pathway which activates hepcidin or it may act as a modulator of hepcidin expression. Defects in hemojuvelin are the cause of hemochromatosis type 2A, also known as juvenile hemochromatosis (JH).

References
  • Papanikolaou G, et al. (2004) Mutations in HFE2 cause iron overload in chromosome 1q-linked juvenile hemochromatosis. Nat Genet. 36(1):77-82.
  • Babitt JL, et al. (2006) Bone morphogenetic protein signaling by hemojuvelin regulates hepcidin expression. Nat Genet. 38(5):531-9.
  • Zhang AS, et al. (2008) Neogenin-mediated hemojuvelin shedding occurs after hemojuvelin traffics to the plasma membrane. J Biol Chem. 283(25):17494-502.
  • Size / Price
    Catalog: CG90061-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"