Quick Order

Text Size:AAA

Cynomolgus monkey CSF1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSF1cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:1668
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) colony stimulating factor 1 (macrophage) DNA.
Gene Synonym:CSF1
Species:Cynomolgus
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Colony-Stimulating Factor (CSF) & Receptor Related Products
Background

Macrophage colony-stimulating factor 1, also known as CSF-1, M-CSF, Lanimostim and CSF1, is a single-pass membrane protein which is disulfide-linked as a homodimer or heterodimer. Granulocyte / macrophage colony-stimulating factors are cytokines that act in hematopoiesis by controlling the production, differentiation, and function of 2 related white cell populations of the blood, the granulocytes and the monocytes-macrophages. M-CSF/CSF-1 is known to facilitate monocyte survival, monocyte-to-macrophage conversion, and macrophage proliferation. M-CSF/CSF-1 is a secreted cytokine which influences hemopoietic stem cells to differentiate into macrophages or other related cell types. It binds to the Colony stimulating factor 1 receptor. M-CSF/CSF-1 may also be involved in development of the placenta. The active form of M-CSF/CSF-1 is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. M-CSF/CSF-1 induces cells of the monocyte/macrophage lineage. It also plays a role in immunological defenses, bone metabolism, lipoproteins clearance, fertility and pregnancy. Upregulation of M-CSF/CSF-1 in the infarcted myocardium may have an active role in healing not only through its effects on cells of monocyte/macrophage lineage, but also by regulating endothelial cell chemokine expression.

References
  1. Pandit J. et al., 1992, Science. 258: 1358-62.
  2. Tokai M. et al., 2000, J Bacteriol. 182 (10): 2865-8.
  3. Fan X. et al., 2001, Am J Physiol Endocrinol Metab. 280 (1): E103-11.
  4. Frangogiannis NG. et al., 2003, Am J Physiol Heart Circ Physiol. 285 (2): H483-92.
  5. Cupp JS. et al., 2007, Am J Surg Pathol. 31 (6): 970-6.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"