Quick Order

Canine IGF2 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Canine IGF2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001195403.1
RefSeq ORF Size:555bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris insulin-like growth factor 2 (somatomedin A) with C terminal Myc tag.
Gene Synonym:IGF2
Species:Canine
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Background

Insulin-like growth factor 2 (IGF-2/IGF-II) is a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. IGF-2/IGF-II is a mediator of prolactin-induced alveologenesis; prolactin, IGF-2, and cyclin D1, all of which are overexpressed in breast cancers, are components of a developmental pathway in the mammary gland. IGF-2 and exhibited statistically significant, positive associations with colorectal cancer risk when cases were confined to those diagnosed within a relatively short time period after enrolment. Circulating IGF-2 and IGFBP-3 can serve as early indicators of impending colorectal cancer. IGF-2/IGF-II appears to be involved in the progression of many tumours. It binds to at least two different types of receptor: IGF type 1 (IGF 1R) and mannose 6-phosphate/IGF type 2 (M6-P/IGF 2R). Ligand binding to IGF 1R provokes mitogenic and anti-apoptotic effects. M6-P/IGF 2R has a tumour suppressor function—it mediates IGF 2 degradation. Mutation of M6-P/IGF 2R causes both diminished growth suppression and augmented growth stimulation. The aim of this study was to investigate the role of IGF 2 and its receptors (IGF 1R and IGF 2R) in human gastric cancer.

References
  • Harvey MB, et al. (1991) IGF-2 receptors are first expressed at the 2-cell stage of mouse development. Development. 111(4): 1057-60.
  • Peters G, et al. (2003) IGF-1R, IGF-1 and IGF-2 expression as potential prognostic and predictive markers in colorectal-cancer. Virchows Arch. 443(2): 139-45.
  • Burrow S, et al. (1998) Expression of insulin-like growth factor receptor, IGF-1, and IGF-2 in primary and metastatic osteosarcoma. J Surg Oncol. 69(1): 21-7.
  • Size / Price
    Catalog: DG70041-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"