Quick Order

Text Size:AAA

Canine CAR9 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Canine CA9 cDNA Clone Product Information
Gene_bank_ref_id:NM_001145174.1
RefSeq ORF Size:1314bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris carbonic anhydrase IX with C terminal Myc tag.
Gene Synonym:CAR9
Species:Canine
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Carbonic anhydrases IX (CA IX), also known as membrane antigen MN or CA9, is a member of the carbonic anhydrase (CA) family and may be involved in cell proliferation and cellular transformation. CAs are zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide (H2O + CO2 = H+ + HCO3–) and thus participate in a variety of biological and physical processes. CA IX protein is expressed primarily in carcinoma cells lines, and the expression is cell density dependent and has been shown to be strongly induced by hypoxia, accordingly facilitates adaptation of tumor cells to hypoxic conditions. It is involved in tumorigenesis through many pathways, such as pH regulation and cell adhesion control. CA IX is used as a marker of tumor hypoxia and as a new therapeutic target for many human carcinomas and cancers.

References
  • Loncaster JA, et al. (2001) Carbonic anhydrase (CA IX) expression, a potential new intrinsic marker of hypoxia: correlations with tumor oxygen measurements and prognosis in locally advanced carcinoma of the cervix. Cancer Res. 61(17): 6394-9.
  • Zvada J, et al. (2003) Soluble form of carbonic anhydrase IX (CA IX) in the serum and urine of renal carcinoma patients. Br J Cancer. 89(6): 1067-71.
  • Pan P, et al. (2006) Carbonic anhydrase gene expression in CA II-deficient (Car2-/-) and CA IX-deficient (Car9-/-) mice. J Physiol. 571(Pt 2): 319-27.
  • Zhou GX, et al. (2010) Quantification of carbonic anhydrase IX expression in serum and tissue of renal cell carcinoma patients using enzyme-linked immunosorbent assay: prognostic and diagnostic potentials. Urology. 75(2): 257-61.
  • Size / Price
    Catalog: DG70002-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"